PAI Gene Information


Name : M28_Spy1309 (M28_Spy1309)
Accession : YP_280774.1
PAI name : RD2
PAI accession : NC_007296_P1
Strain : Streptococcus pyogenes A20
Virulence or Resistance: Not determined
Product : hypothetical protein
Function : -
Note : -
Homologs in the searched genomes :   20 hits    ( 20 protein-level )  
Publication :
    -Green,N.M., Zhang,S., Porcella,S.F., Nagiec,M.J., Barbian,K.D., Beres,S.B., LeFebvre,R.B. and Musser,J.M., "Genome sequence of a serotype M28 strain of group a streptococcus: potential new insights into puerperal sepsis and bacterial disease specificity", J. Infect. Dis. 192 (5), 760-770 (2005) PUBMED 16088825.

    -Green,N.M., Zhang,S., Porcella,S.F., Nagiec,M.J., Barbian,K.D., Beres,S.B., LeFebvre,R.B. and Musser,J.M., "Direct Submission", Submitted (08-AUG-2005) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.

    -Green,N.M., Zhang,S., Porcella,S.F., Nagiec,M.J., Barbian,K.D., Beres,S.B., LeFebvre,R.B. and Musser,J.M., "Direct Submission", Submitted (21-MAR-2005) Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Disease, National Institutes of Health, 903 S. 4th Street, Hamilton, MT 59840, USA.


DNA sequence :
ATGGGCAATTCATCAAAATCCAACAGAAAGGAGGAGCTAGATTTGTCTACCTTTGAGGTCTTAACACTCATGTTTATAGC
AGGTAACTTCGTTATCGCTCTCGTGAAGTTAGTCCTTGAACTGGTAAAATCGACAAAAAAATAA

Protein sequence :
MGNSSKSNRKEELDLSTFEVLTLMFIAGNFVIALVKLVLELVKSTKK