PAI Gene Information


Name : SE1473 (SE1473)
Accession : NP_765028.1
PAI name : vSe2
PAI accession : NC_004461_P2
Strain : Staphylococcus epidermidis ATCC 12228
Virulence or Resistance: Not determined
Product : hypothetical protein
Function : -
Note : -
Homologs in the searched genomes :   1 hits    ( 1 protein-level )  
Publication :
    -Zhang,Y., Ren,S., Li,H., Fu,G., Lu,L., Lu,G., Jia,J., Tu,Y., Qin,Z., Chen,Z. and Wen,Y., "Direct Submission", Submitted (05-NOV-2002) Chinese National Human Genome Center at Shanghai, 250 Bi Bo Road, Shanghai 201203, China.

    -Zhang,Y.Q., Ren,S.X., Li,H.L., Wang,Y.X., Fu,G., Yang,J., Qin,Z.Q., Miao,Y.G., Wang,W.Y., Chen,R.S., Shen,Y., Chen,Z., Yuan,Z.H., Zhao,G.P., Qu,D., Danchin,A. and Wen,Y.M., "Genome-based analysis of virulence genes in a non-biofilm-forming Staphylococcus epidermidis strain (ATCC 12228)", Mol. Microbiol. 49 (6), 1577-1593 (2003) PUBMED 12950922.

    -Zhang,Y.Q., Ren,S.X., Li,H.L., Wang,Y.X., Fu,G., Yang,J., Qin,Z.Q., Miao,Y.G., Wang,W.Y., Chen,R.S., Shen,Y., Chen,Z., Yuan,Z.H., Zhao,G.P., Qu,D., Danchin,A. and Wen,Y.M., "Direct Submission", Submitted (10-SEP-2004) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.


DNA sequence :
ATGCATATTTCGCATCTATTAGATGAAGTAGAGCAGACAGAAAGAGAAAAAGCAGTGAATGTATTGGAAAATATGAACGG
GAACGTAATTTAA

Protein sequence :
MHISHLLDEVEQTEREKAVNVLENMNGNVI