PAI Gene Information


Name : unnamed
Accession : AEZ06041.1
PAI name : Tn6167
PAI accession : JN968483_R1
Strain : Acinetobacter baumannii 1656-2
Virulence or Resistance: Not determined
Product : hypothetical protein
Function : -
Note : -
Homologs in the searched genomes :   9 hits    ( 9 protein-level )  
Publication :
    -Hamidian,M. and Hall,R.M., "ISAba1 targets a specific position upstream of the intrinsic ampC gene of Acinetobacter baumannii leading to cephalosporin resistance", Unpublished.

    -Kenyon,J.J. and Hall,R.M., "Variation in the Complex Carbohydrate Biosynthesis Loci of Acinetobacter baumannii Genomes", PLoS ONE 8 (4), E62160 (2013) PUBMED 23614028 REMARK Publication Status: Online-Only.

    -Nigro,S.J. and Hall,R.M., "Tn6167, an antibiotic resistance island in an Australian carbapenem-resistant Acinetobacter baumannii GC2, ST92 isolate", J. Antimicrob. Chemother. 67 (6), 1342-1346 (2012) PUBMED 22351684.

    -Nigro,S.J. and Hall,R.M., "Direct Submission", Submitted (28-OCT-2011) School of Molecular Bioscience, The University of Sydney, Building G08, Sydney, NSW 2006, Australia.

    -Nigro,S.J., Kenyon,J.J., Hamidian,M., Holt,K.E., Pickard,D., Dougan,G. and Hall,R.M., "Direct Submission", Submitted (16-MAY-2013) School of Molecular Bioscience, The University of Sydney, Building G08, Sydney, NSW 2006, Australia REMARK Sequence update by submitter.

    -Nigro,S.J., Kenyon,J.J., Holt,K.E., Pickard,D., Dougan,G. and Hall,R.M., "Direct Submission", Submitted (29-APR-2013) School of Molecular Bioscience, The University of Sydney, Building G08, Sydney, NSW 2006, Australia REMARK Sequence update by submitter.


DNA sequence :
ATGGCAAGCACAGCAGCAGAGCGTAAAGCAAAACAACGCCAAGAAATGTTAAAAAAAGGGTTCACGCGTAAGGATCTTTG
GTTATCAAAAGAAAGTTTAGAGGTAATAGAAAAATTTAAATCAGAGCATAAATTGAGCTCAAATGATGAAGCAATTAATC
TTTTACTAAAAACAATTGTGGTAATAGAAAAATTCAAATCGGAGCATAAATTTAACACTATAGATGAAGTAATTAATCTT
TTCTTAAAATCTCTTAATGAGTGCAAATAA

Protein sequence :
MASTAAERKAKQRQEMLKKGFTRKDLWLSKESLEVIEKFKSEHKLSSNDEAINLLLKTIVVIEKFKSEHKFNTIDEVINL
FLKSLNECK