PAI Gene Information


Name : sup
Accession : ADZ05775.1
PAI name : AbaR11
PAI accession : JF262167
Strain : Acinetobacter baumannii 1656-2
Virulence or Resistance: Resistance
Product : sulphate permease
Function : -
Note : coding region disrupted by sequencing gap
Homologs in the searched genomes :   No hits  
Publication :
    -Krizova,L. and Nemec,A., "Direct Submission", Submitted (20-JAN-2011) Laboratory of Bacterial Genetics, National Institute of Public Health in Prague, Srobarova 48, Prague 10 100 42, Czech Republic.

    -Krizova,L., Dijkshoorn,L. and Nemec,A., "Diversity and Evolution of AbaR Genomic Resistance Islands in Acinetobacter baumannii Strains of European Clone I", Antimicrob. Agents Chemother. 55 (7), 3201-3206 (2011) PUBMED 21537009.


DNA sequence :
ATGTTTTCCAATGTACGAGAGCAATGGTTCTCGAATATCCGTGGTGATGTACTTTCGGGTATTGTC

Protein sequence :
MFSNVREQWFSNIRGDVLSGIV