PAI Gene Information


Name : prgH
Accession : AAX49612.1
PAI name : SPI-1
PAI accession : AY956822
Strain : Salmonella enterica RSK2980
Virulence or Resistance: Virulence
Product : PrgH
Function : -
Note : similar to needle complex inner membrane/cell invasion protein (prgH) of Salmonella typhimurium LT2 of GenBank Accession Number AAL21754
Homologs in the searched genomes :   No hits  
Publication :
    -Chae,J.S., "Direct Submission", Submitted (27-FEB-2005) Department of Veterinary Internal Medicine, College of Veterinary Medicine, Chonbuk National University, Jeonju, Jeonbuk 561-756, South Korea.

    -Shah,D.H., Lee,M.J., Park,J.H., Lee,J.H., Eo,S.K., Kwon,J.T. and Chae,J.S., "Identification of Salmonella gallinarum virulence genes in a chicken infection model using PCR-based signature-tagged mutagenesis", Microbiology (Reading, Engl.) 151 (PT 12), 3957-3968 (2005) PUBMED 16339940.


DNA sequence : 
GGCTCAAGGGGCGCTCATTTCAGTACGGGGCGGAAGGTTATATCAAAATGAGCCCAGGCCATTGGTATTTCCCAAGCCCA
CTTTAA

Protein sequence : 
LKGRSFQYGAEGYIKMSPGHWYFPSPL