PAI Gene Information


Name : unnamed
Accession : AAK00484.1
PAI name : SHI-1
PAI accession : AF200692
Strain : Shigella flexneri 2002017
Virulence or Resistance: Not determined
Product : unknown
Function : -
Note : ORF30
Homologs in the searched genomes :   84 hits    ( 81 protein-level,   3 DNA-level )  
Publication :
    -Al-Hasani,K., Henderson,I.R., Sakellaris,H., Rajakumar,K., Grant,T., Nataro,J.P., Robins-Browne,R. and Adler,B., "The sigA gene which is borne on the she pathogenicity island of Shigella flexneri 2a encodes an exported cytopathic protease involved in intestinal fluid accumulation", Infect. Immun. 68 (5), 2457-2463 (2000) PUBMED 10768931.

    -Al-Hasani,K., Rajakumar,K. and Adler,B., "Direct Submission", Submitted (01-NOV-1999) Microbiology, Monash University, Wellington Road, Clayton, Vic 3800, Australia.

    -Al-Hasani,K., Rajakumar,K., Adler,B. and Sakellaris,H., "Direct Submission", Submitted (16-JAN-2001) Microbiology, Monash University, Wellington Road, Clayton, Vic 3800, Australia REMARK Sequence update by submitter.

    -Al-Hasani,K., Rajakumar,K., Bulach,D., Robins-Browne,R., Adler,B. and Sakellaris,H., "Genetic organization of the she pathogenicity island in Shigella flexneri 2a", Microb. Pathog. 30 (1), 1-8 (2001) PUBMED 11162180.


DNA sequence : 
ATGAAATTATTAACCACAGAAACGGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATTGACTGCGAATCAGGGAT
TATCTTCGACAACGATGAGGATAAAACGGATTCGGCAGCACTGCTGCCCTGTATTGAACAGGCCAGGGAAGATATCCGTA
CCCTGCGTCAGCTGCAGTTTCTGCAACAGAACCGGTGA

Protein sequence : 
MKLLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDIRTLRQLQFLQQNR