PAI Gene Information


Name : unnamed
Accession : -
PAI name : vap locus
PAI accession : X98545
Strain : Dichelobacter nodosus VCS1703A
Virulence or Resistance: Not determined
Product : -
Function : -
Note : -
Homologs in the searched genomes :   36 hits    ( 36 DNA-level )  
Publication :
    -Bloomfield,G.A., Whittle,G., McDonagh,M.B., Katz,M.E. and Cheetham,B.F., "Analysis of sequences flanking the vap regions of Dichelobacter nodosus: evidence for multiple integration events, a killer system, and a new genetic element", Microbiology (Reading, Engl.) 143 (PT 2), 553-562 (1997) PUBMED 9043132.

    -Cheetham,B.F., "Direct Submission", Submitted (17-JUN-1996) B.F. Cheetham, Department Molecular & Cellular Biology, University of New England, Armidale, NSW 2351, AUSTRALIA.


DNA sequence : 
GGACAGGTGGCGGAGTGGTGGAACGCACACACCTGGAAAGTGTGTATACGTTAATAGCGTATCGGGGGTTCGAATCCCCC
CCTGTCCGCCA

Protein sequence : 
-