PAI Gene Information


Name : unnamed
Accession : -
PAI name : Type-IVa SCCmec
PAI accession : NC_016941_R1
Strain : Staphylococcus aureus 04-02981
Virulence or Resistance: Not determined
Product : -
Function : -
Note : inverted complementary repeat(IR-R) of SCCmec of MSHR1132
Homologs in the searched genomes :   No hits  
Publication :
    -Holt,D.C., Holden,M.T., Tong,S.Y., Castillo-Ramirez,S., Clarke,L., Quail,M.A., Currie,B.J., Parkhill,J., Bentley,S.D., Feil,E.J. and Giffard,P.M., "A very early-branching Staphylococcus aureus lineage lacking the carotenoid pigment staphyloxanthin", Genome Biol Evol 3, 881-895 (2011) PUBMED 21813488.

    -Holt,D.C., Holden,M.T., Tong,S.Y., Castillo-Ramirez,S., Clarke,L., Quail,M.A., Currie,B.J., Parkhill,J., Bentley,S.D., Feil,E.J. and Giffard,P.M., "Direct Submission", Submitted (27-FEB-2012) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.


DNA sequence : 
AGCATATCATAAATGATGCGGTTTTTT

Protein sequence : 
-