PAI Gene Information


Name : Pmu_02670 (Pmu_02670)
Accession : -
PAI name : ICEPmu1
PAI accession : NC_016808_R1
Strain : Pasteurella multocida 36950
Virulence or Resistance: Not determined
Product : -
Function : -
Note : tRNA-Leu; gene disrupted by the insertion of an integrative and conjugative element (ICE)
Homologs in the searched genomes :   2 hits    ( 2 DNA-level )  
Publication :
    -Brenner-Michael,G., Kadlec,K., Sweeney,M.T., Brzuszkiewicz,E., Liesegang,H., Daniel,R., Watts,J.L. and Schwarz,S., "Direct Submission", Submitted (19-AUG-2011) Institute of Farm Animal Genetics (FLI), Neustadt-Mariensee, Lower-Saxony 31535, Germany.

    -Michael,G.B., Kadlec,K., Sweeney,M.T., Brzuszkiewicz,E., Liesegang,H., Daniel,R., Murray,R.W., Watts,J.L. and Schwarz,S., "ICEPmu1, an integrative conjugative element (ICE) of Pasteurella multocida: structure and transfer", J. Antimicrob. Chemother. (2011) In press PUBMED 22001176 REMARK Publication Status: Available-Online prior to print.

    -Michael,G.B., Kadlec,K., Sweeney,M.T., Brzuszkiewicz,E., Liesegang,H., Daniel,R., Murray,R.W., Watts,J.L. and Schwarz,S., "Direct Submission", Submitted (06-FEB-2012) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.


DNA sequence : 
TTGATTCAAAATCAACCGCCTTCGGGTGTGCCGGTTCGAGTCCGGCCCTAGGCA

Protein sequence : 
-