PAI Gene Information


Name : YpsIP31758_4281 (YpsIP31758_4281)
Accession : -
PAI name : YAPI
PAI accession : NC_009708_P1
Strain : Yersinia pseudotuberculosis IP 31758
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : -
Homologs in the searched genomes :   693 hits    ( 693 DNA-level )  
Publication :
    -Eppinger,M., Rosovitz,M., Fricke,W.W., Rasko,D.A., Lindler,L.E., Carniel,E. and Ravel,J., "Direct Submission", Submitted (05-JUN-2007) Microbial Genomics and Pathogen Functional Genomic Resource Center, J. Craig Venter Institute, 9712 Medical Center Drive, Rockville, MD 20850, USA.

    -Eppinger,M., Rosovitz,M.J., Fricke,W.F., Rasko,D.A., Kokorina,G., Fayolle,C., Lindler,L.E., Carniel,E. and Ravel,J., "The complete genome sequence of Yersinia pseudotuberculosis IP31758, the causative agent of Far East scarlet-like fever", PLoS Genet. 3 (8), E142 (2007) PUBMED 17784789.

    -Eppinger,M., Rosovitz,M.J., Fricke,W.F., Rasko,D.A., Kokorina,G., Fayolle,C., Lindler,L.E., Carniel,E. and Ravel,J., "Direct Submission", Submitted (26-JUL-2007) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.


DNA sequence :
TGCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAT

Protein sequence :
-