PAI Gene Information


Name : YEt075 (YEt075)
Accession : -
PAI name : YAPI
PAI accession : NC_008800_P2
Strain : Yersinia enterocolitica 8081
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : -
Homologs in the searched genomes :   709 hits    ( 709 DNA-level )  
Publication :
    -Delihas,N., "Annotation and evolutionary relationships of a small regulatory RNA gene micF and its target ompF in Yersinia species", BMC Microbiol. 3, 13 (2003) PUBMED 12834539 REMARK Publication Status: Online-Only.

    -Delihas,N., "Direct Submission", Submitted (19-JAN-2007) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.

    -Thomson,N.R., "Direct Submission", Submitted (30-JUN-2006) Thomson N.R., Pathogen Sequencing Unit, The Wellcome Trust Sanger Institute, Genome Campus, Hinxton, Cambridge, CB10 1SA, UNITED KINGDOM.

    -Thomson,N.R., Howard,S., Wren,B.W., Holden,M.T., Crossman,L., Challis,G.L., Churcher,C., Mungall,K., Brooks,K., Chillingworth,T., Feltwell,T., Abdellah,Z., Hauser,H., Jagels,K., Maddison,M., Moule,S., Sanders,M., Whitehead,S., Quail,M.A., Dougan,G., Parkh, "The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081", PLoS Genet. 2 (12), E206 (2006) PUBMED 17173484.


DNA sequence : 
GCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCA

Protein sequence : 
-