PAI Gene Information


Name : YP_t35 (YP_t35)
Accession : -
PAI name : HPI
PAI accession : NC_005810_P1
Strain : Yersinia pestis A1122
Virulence or Resistance: Not determined
Product : tRNA-Asn
Function : -
Note : Cove score 87.13
Homologs in the searched genomes :   1142 hits    ( 1142 DNA-level )  
Publication :
    -Song,Y., Tong,Z., Wang,J., Wang,L., Guo,Z., Han,Y., Zhang,J., Pei,D., Zhou,D., Qin,H., Pang,X., Han,Y., Zhai,J., Li,M., Cui,B., Qi,Z., Jin,L., Dai,R., Chen,F., Li,S., Ye,C., Du,Z., Lin,W., Wang,J., Yu,J., Yang,H., Wang,J., Huang,P. and Yang,R., "Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans", DNA Res. 11 (3), 179-197 (2004) PUBMED 15368893.

    -Song,Y., Tong,Z., Wang,J., Wang,L., Guo,Z., Han,Y., Zhang,J., Pei,D., Zhou,D., Qin,H., Pang,X., Han,Y., Zhai,J., Li,M., Cui,B., Qi,Z., Jin,L., Dai,R., Chen,F., Li,S., Ye,C., Du,Z., Lin,W., Wang,J., Yu,J., Yang,H., Wang,J., Huang,P. and Yang,R., "Direct Submission", Submitted (11-SEP-2004) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.

    -Song,Y., Tong,Z., Wang,L., Han,Y., Zhang,J., Pei,D., Wang,J., Zhou,D., Han,Y., Pang,X., Zhai,J., Chen,F., Qin,H., Wang,J., Li,S., Guo,Z., Ye,C., Du,Z., Lin,W., Wang,J., Yu,J., Yang,H., Wang,J., Huang,P. and Yang,R., "Direct Submission", Submitted (24-APR-2003) The Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, No. 20, Dongdajie Street, Fengtai District, Beijing 100071, People's Republic of China.

    -Zhou,D., Tong,Z., Song,Y., Han,Y., Pei,D., Pang,X., Zhai,J., Li,M., Cui,B., Qi,Z., Jin,L., Dai,R., Du,Z., Wang,J., Guo,Z., Wang,J., Huang,P. and Yang,R., "Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus", J. Bacteriol. 186 (15), 5147-5152 (2004) PUBMED 15262951.


DNA sequence :
TCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA

Protein sequence :
-