PAI Gene Information


Name : tRNA-Ser (DIPt08)
Accession : -
PAI name : Not named
PAI accession : NC_002935_P2
Strain : Corynebacterium diphtheriae 241
Virulence or Resistance: Not determined
Product : tRNA-Ser
Function : -
Note : tRNA Ser anticodon GCT, Cove score 42.39
Homologs in the searched genomes :   134 hits    ( 134 DNA-level )  
Publication :
    -Cerdeno-Tarraga,A.M., "Direct Submission", Submitted (03-OCT-2003) Cerdeno-Tarraga A.M., submitted on behalf of the Pathogen Sequencing Unit, Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA E-mail: amct@sanger.ac.uk.

    -Cerdeno-Tarraga,A.M., "Direct Submission", Submitted (08-APR-2002) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.

    -Cerdeno-Tarraga,A.M., Efstratiou,A., Dover,L.G., Holden,M.T., Pallen,M., Bentley,S.D., Besra,G.S., Churcher,C., James,K.D., De Zoysa,A., Chillingworth,T., Cronin,A., Dowd,L., Feltwell,T., Hamlin,N., Holroyd,S., Jagels,K., Moule,S., Quail,M.A., Rabbinowits, "The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129", Nucleic Acids Res. 31 (22), 6516-6523 (2003) PUBMED 14602910.


DNA sequence :
GGAGACGTGCCAGAGCGGCCGAATGGGGCTCCCTGCTAAGGAGTTGACTTGTTTGCGCAGGTCCGGAGGTTCAAATCCTC
TCGTCTCCG

Protein sequence :
-