PAI Gene Information


Name : unnamed
Accession : -
PAI name : KpGI-2
PAI accession : FJ389723
Strain : Klebsiella pneumoniae SB3432
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : -
Homologs in the searched genomes :   693 hits    ( 693 DNA-level )  
Publication :
    -Chen,N., Ou,H.-Y., Jiang,X.Fei., Li,M., Yang,Z.Hua., Wei,Q.Hao., Li,G., Chen,X.Yun., Aartsen,J.Jurriaanvan., He,X., Deng,Z., Rajakumar,K. and Lu,Y., "Direct Submission", Submitted (16-OCT-2008) Huashan Hospital, Shanghai Medical College, Fudan University, Department of Laboratory Medicine, 12 Central Wurumuqi Road, Shanghai 200040, People's Republic of China.

    -Chen,N., Ou,H.Y., van Aartsen,J.J., Jiang,X., Li,M., Yang,Z., Wei,Q., Chen,X., He,X., Deng,Z., Rajakumar,K. and Lu,Y., "The pheV phenylalanine tRNA gene Klebsiella pneumoniae clinical isolates is an integration hotspot for possible niche-adaptation genomic islands", Curr. Microbiol. 60 (3), 210-216 (2010) PUBMED 19921332.


DNA sequence :
TGCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAC

Protein sequence :
-