PAI Gene Information


Name : unnamed
Accession : -
PAI name : ExoU island A
PAI accession : DQ437742
Strain : Pseudomonas aeruginosa B136-33
Virulence or Resistance: Not determined
Product : tRNA-Lys
Function : -
Note : -
Homologs in the searched genomes :   699 hits    ( 699 DNA-level )  
Publication :
    -Kulasekara,B.R., Kulasekara,H.D., Wolfgang,M.C., Stevens,L., Frank,D.W. and Lory,S., "Acquisition and evolution of the exoU locus in Pseudomonas aeruginosa", J. Bacteriol. 188 (11), 4037-4050 (2006) PUBMED 16707695.

    -Kulasekara,B.R., Kulasekara,H.D., Wolfgang,M.C., Stevens,L., Frank,D.W. and Lory,S., "Direct Submission", Submitted (07-MAR-2006) Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Ave, Boston, MA 02115, USA.


DNA sequence :
GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGTAGGTTCGAATCCTACACGACCCACCA

Protein sequence :
-