PAI Gene Information


Name : unnamed
Accession : -
PAI name : Hrp PAI
PAI accession : AY906859
Strain : Erwinia amylovora ATCC 49946
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : -
Homologs in the searched genomes :   713 hits    ( 713 DNA-level )  
Publication :
    -Oh,C.-S., Kim,J.F. and Beer,S.V., "The Hrp pathogenicity island of Erwinia amylovora and identification of three novel genes required for systemic infection", Mol. Plant Pathol. 6 (2005) In press.

    -Oh,C.-S., Kim,J.F. and Beer,S.V., "Direct Submission", Submitted (26-JAN-2005) Plant Pathology, Cornell University, 334 Plant Science Building, Ithaca, NY 14853, USA.


DNA sequence : 
CCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCA

Protein sequence : 
-