Name : unnamed
Accession : -
PAI name : AGI-3
PAI accession : AY857617
Strain : Escherichia coli 042
Virulence or Resistance: Not determined
Product : tRNA-Sec
Function : -
Note : selC
Homologs in the searched genomes : 166 hits ( 166 DNA-level )
Publication :
-Chouikha,I., Germon,P., Bree,A., Gilot,P., Moulin-Schouleur,M. and Schouler,C., "A selC-associated genomic island of the extraintestinal avian pathogenic Escherichia coli strain BEN2908 is involved in carbohydrate uptake and virulence", J. Bacteriol. 188 (3), 977-987 (2006) PUBMED 16428402.
-Schouler,C., "Direct Submission", Submitted (15-DEC-2004) UR86, INRA, Nouzilly 37390, France.
| DNA sequence : | |
GGAAGATCGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTTGGGGCCGCCAGCGGTCCCGGGCAGGTTCGACTCC
TGTGATCTTCCGCCA
|
| Protein sequence : | |
-
|
|
