PAI Gene Information


Name : unnamed
Accession : -
PAI name : PAPI-2
PAI accession : AY273870
Strain : Pseudomonas aeruginosa B136-33
Virulence or Resistance: Not determined
Product : tRNA-Lys
Function : -
Note : believed to involved in recombination of PAPI-2
Homologs in the searched genomes :   699 hits    ( 699 DNA-level )  
Publication :
    -He,J. and Rahme,L.G., "Direct Submission", Submitted (09-APR-2003) Department of Surgery and Department of Molecular Biology, Massachusetts General Hospital and Boston Shriners Institute, Harvard Medical School, 55 Fruit Street, Boston, MA 02114, USA.

    -He,J., Baldini,R.L., Deziel,E., Saucier,M., Zhang,Q., Liberati,N.T., Lee,D., Urbach,J., Goodman,H.M. and Rahme,L.G., "The broad host range pathogen Pseudomonas aeruginosa strain PA14 carries two pathogenicity islands harboring plant and animal virulence genes", Proc. Natl. Acad. Sci. U.S.A. 101 (8), 2530-2535 (2004) PUBMED 14983043.


DNA sequence : 
GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGTAGGTTCGAATCCTACACGACCCACCA

Protein sequence : 
-