PAI Gene Information


Name : unnamed
Accession : -
PAI name : Not named
PAI accession : AY151282
Strain : Escherichia coli 042
Virulence or Resistance: Not determined
Product : tRNA-Trp
Function : -
Note : -
Homologs in the searched genomes :   195 hits    ( 195 DNA-level )  
Publication :
    -Parreira,V.R. and Gyles,C.L., "A novel pathogenicity island integrated adjacent to the thrW tRNA gene of avian pathogenic Escherichia coli encodes a vacuolating autotransporter toxin", Infect. Immun. 71 (9), 5087-5096 (2003) PUBMED 12933851.

    -Parreira,V.R. and Gyles,C.L., "Direct Submission", Submitted (18-SEP-2002) Pathobiology, University of Guelph, Ontario Veterinary College, Guelph, ON N1G2W1, Canada.


DNA sequence : 
GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCG

Protein sequence : 
-