PAI Gene Information


Name : tRNA-Pro
Accession : -
PAI name : PPHGI-1
PAI accession : AJ870974
Strain : Pseudomonas syringae 1448A
Virulence or Resistance: Not determined
Product : tRNA-Pro
Function : -
Note : -
Homologs in the searched genomes :   155 hits    ( 155 DNA-level )  
Publication :
    -Pitman,A.R., "Direct Submission", Submitted (09-DEC-2004) Pitman A.R., Centre for Research in Plant Science, University of the West of England, Colharbour Lane, Bristol BS16 1QY, United Kingdom.

    -Pitman,A.R., Jackson,R.W., Mansfield,J.W., Kaitell,V., Thwaites,R. and Arnold,D.L., "Exposure to host resistance mechanisms drives evolution of bacterial virulence in plants", Curr. Biol. 15 (24), 2230-2235 (2005) PUBMED 16360685.


DNA sequence :
CGGGGTATAGCGCAGTCCGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCAGGAGTTCGAATCCCCTTACCCCGA

Protein sequence :
-