PAI Gene Information


Name : unnamed
Accession : -
PAI name : YAPI
PAI accession : AJ627388
Strain : Yersinia pseudotuberculosis IP 31758
Virulence or Resistance: Not determined
Product : -
Function : -
Note : -
Homologs in the searched genomes :   7 hits    ( 7 DNA-level )  
Publication :
    -Collyn,F., "Direct Submission", Submitted (03-FEB-2004) Collyn F., E0364, Inserm, 1, rue du Professeur Calmette, Lille, 59021, FRANCE.

    -Collyn,F., Billault,A., Mullet,C., Simonet,M. and Marceau,M., "YAPI, a new Yersinia pseudotuberculosis pathogenicity island", Infect. Immun. 72 (8), 4784-4790 (2004) PUBMED 15271940.

    -Collyn,F., Lety,M.A., Nair,S., Escuyer,V., Ben Younes,A., Simonet,M. and Marceau,M., "Yersinia pseudotuberculosis harbors a type IV pilus gene cluster that contributes to pathogenicity", Infect. Immun. 70 (11), 6196-6205 (2002) PUBMED 12379698.


DNA sequence :
AATAATGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCC

Protein sequence :
-