PAI Gene Information


Name : tRNA-Phe (GAA)
Accession : -
PAI name : PAI V 536
PAI accession : AJ617685
Strain : Escherichia coli 042
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : codon recognized: UUC
Homologs in the searched genomes :   709 hits    ( 709 DNA-level )  
Publication :
    -Dobrindt,U., "Direct Submission", Submitted (11-NOV-2003) Dobrindt U., Inst. f. Molekulare Infektionsbiologie, Universitaet Wuerzburg, Roentgenring 11, 97070 Wuerzburg, GERMANY.

    -Schneider,G., Dobrindt,U., Bruggemann,H., Nagy,G., Janke,B., Blum-Oehler,G., Buchrieser,C., Gottschalk,G., Emody,L. and Hacker,J., "The pathogenicity island-associated K15 capsule determinant exhibits a novel genetic structure and correlates with virulence in uropathogenic Escherichia coli strain 536", Infect. Immun. 72 (10), 5993-6001 (2004) PUBMED 15385503.


DNA sequence :
GCCCGGATAGCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCA

Protein sequence :
-