PAI Gene Information


Name : tRNA-Leu
Accession : -
PAI name : PAI II 536
PAI accession : AJ494981
Strain : Escherichia coli 042
Virulence or Resistance: Not determined
Product : tRNA-Leu
Function : -
Note : codon recognized: UUG
Homologs in the searched genomes :   233 hits    ( 233 DNA-level )  
Publication :
    -Dobrindt,U., "Direct Submission", Submitted (11-JUL-2002) Dobrindt U., Inst. f. Molekulare Infektionsbiologie, Universitaet Wuerzburg, Roentgenring 11, 97070 Wuerzburg, GERMANY.

    -Dobrindt,U., Blum-Oehler,G., Nagy,G., Schneider,G., Johann,A., Gottschalk,G. and Hacker,J., "Genetic structure and distribution of four pathogenicity islands (PAI I(536) to PAI IV(536)) of uropathogenic Escherichia coli strain 536", Infect. Immun. 70 (11), 6365-6372 (2002) PUBMED 12379716.


DNA sequence :
GCCGAAGTGGCGAAATCGGTAGACGCAGTTGATTCAAAATCAACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCGG
CACCA

Protein sequence :
-