PAI Gene Information


Name : tRNA-Asn
Accession : -
PAI name : HPI
PAI accession : AJ009592
Strain : Yersinia pseudotuberculosis IP 31758
Virulence or Resistance: Not determined
Product : tRNA-Asn
Function : -
Note : codon recognized: AAC
Homologs in the searched genomes :   1022 hits    ( 1022 DNA-level )  
Publication :
    -Brosch,R., "Direct Submission", Submitted (16-JUL-1998) Brosch R., Genetique Moleculaire Bacterienne, Pasteur Institut Paris, 28, rue du Dr.Roux, 75724 Paris, CEDEX 15, FRANCE.

    -Buchrieser,C., Brosch,R., Bach,S., Guiyoule,A. and Carniel,E., "The high-pathogenicity island of Yersinia pseudotuberculosis can be inserted into any of the three chromosomal asn tRNA genes", Mol. Microbiol. 30 (5), 965-978 (1998) PUBMED 9988474.


DNA sequence : 
TTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAA

Protein sequence : 
-