PAI Gene Information


Name : unnamed
Accession : -
PAI name : Hrp PAI
PAI accession : AF499777
Strain : Xanthomonas axonopodis 306
Virulence or Resistance: Not determined
Product : -
Function : -
Note : putative imperfect PIP-box
Homologs in the searched genomes :   No hits  
Publication :
    -Kim,J.-G., Park,B.K., Yoo,C.-H. and Hwang,I., "Direct Submission", Submitted (09-APR-2002) School of Agricultural Biotechnology, Seoul National University, 103 Seodundong, Kwonsungu, Suwon, Kyunggido 441-744, Korea.

    -Kim,J.G., Park,B.K., Yoo,C.H., Jeon,E., Oh,J. and Hwang,I., "Characterization of the Xanthomonas axonopodis pv. glycines Hrp pathogenicity island", J. Bacteriol. 185 (10), 3155-3166 (2003) PUBMED 12730176.


DNA sequence : 
TTCGCTTGCCTGCTAAGTGTTTCGT

Protein sequence : 
-