PAI Gene Information


Name : unnamed
Accession : -
PAI name : SPI-6
PAI accession : AF376036
Strain : Salmonella enterica RSK2980
Virulence or Resistance: Not determined
Product : tRNA-Phe
Function : -
Note : similar to Escherichia coli pheV gene, GenBank Accession Number X02480
Homologs in the searched genomes :   698 hits    ( 698 DNA-level )  
Publication :
    -Zhao,Y., Jansen,R., Gaastra,W. and van Putten,J.P.M., "Identification of Salmonella Pathogenicity Island in Salmonella enterica required for cellular infection of chicken macrophages", Unpublished.

    -Zhao,Y., Jansen,R., Gaastra,W. and van Putten,J.P.M., "Direct Submission", Submitted (03-MAY-2001) Department of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, Utrecht 3584 CL, The Netherlands.


DNA sequence :
TGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCCCTGCTCTACCGACTGAGCTATCCGGGC

Protein sequence :
-