PAI Gene Information


Name : unnamed
Accession : -
PAI name : Type-IVc SCCmec
PAI accession : AB096217
Strain : Staphylococcus aureus 04-02981
Virulence or Resistance: Not determined
Product : -
Function : -
Note : inverted complementary repeat(IR-L)of IE25923
Homologs in the searched genomes :   No hits  
Publication :
    -Ito,T., Okuma,K., Ma,X.X., Yuzawa,H. and Hiramatsu,K., "Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC", Drug Resist. Updat. 6 (1), 41-52 (2003) PUBMED 12654286.

    -Xue,M.X., Ito,T. and Hiramatsu,K., "Direct Submission", Submitted (14-NOV-2002) Contact:Teruyo Ito Juntendo University, Department of Bacteriology; Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421, Japan.


DNA sequence :
AAAAACCTCATCATCAACCGATAAGC

Protein sequence :
-