PAI Gene Information


Name : unnamed
Accession : -
PAI name : Type-IVa SCCmec
PAI accession : AB063172
Strain : Staphylococcus aureus 04-02981
Virulence or Resistance: Not determined
Product : -
Function : -
Note : inverted complementary repeat(IR-L) of SCCmec of JCSC1968
Homologs in the searched genomes :   No hits  
Publication :
    -Hiramatsu,K., Cui,L., Kuroda,M. and Ito,T., "The emergence and evolution of methicillin-resistant Staphylococcus aureus", Trends Microbiol. 9 (10), 486-493 (2001) PUBMED 11597450.

    -Ito,T., Okuma,K., Ma,X.X., Yuzawa,H. and Hiramatsu,K., "Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC", Drug Resist. Updat. 6 (1), 41-52 (2003) PUBMED 12654286.

    -Ma,X.X., Ito,T., Tiensasitorn,C., Jamklang,M., Chongtrakool,P., Boyle-Vavra,S., Daum,R.S. and Hiramatsu,K., "Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains", Antimicrob. Agents Chemother. 46 (4), 1147-1152 (2002) PUBMED 11897611.

    -Xue,M.X., Ito,T., Hiramatsu,K. and Tiensasitorn,C., "Direct Submission", Submitted (12-JUN-2001) Contact:Teruyo Ito Juntendo University, Department of Bacteriology; Hongo 2-1-1, Bunkyo-ku, Tokyo 113-8421, Japan.


DNA sequence :
GCTTATCAGTTAATGATGCGGTTTTT

Protein sequence :
-