Name : iacP (SEEB0189_05765) Accession : YP_008307504.1 Strain : Salmonella enterica CFSAN000189 Genome accession: NC_021844 Putative virulence/resistance : Virulence Product : acyl carrier protein Function : - COG functional category : - COG ID : - EC number : - Position : 1117876 - 1118124 bp Length : 249 bp Strand : + Note : invasion-associated ACP; carries the fatty acid chain in fatty acid biosynthesis; Derived by automated computational analysis using gene prediction method: Protein Homology. DNA sequence : ATGAATATGGATATTGAAGCAAGAGTCAAAAAAGTGATCACCTCTTGTATTGCCGTTGATGTTGATAGTATCAATGGTCA GACCCATCTGGTTGAGGATCTTTACGCTGACTCATTGGATTTAATTGATATTGTATTTGGTCTTAGTGAGGAGTTTGACA TTAGTTGCAATGAAAACGATCTTCCTGATATGACGACCTTTGCGGATATATGCCGTGTTGTTAAAAAAAGTCTTGAGTCC AGGGTGTAG Protein sequence : MNMDIEARVKKVITSCIAVDVDSINGQTHLVEDLYADSLDLIDIVFGLSEEFDISCNENDLPDMTTFADICRVVKKSLES RV |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
sipF | NP_806484.1 | acyl carrier protein | Virulence | SPI-1 | Protein | 8e-32 | 100 |
sipF | NP_457275.1 | probable acyl carrier protein | Not tested | SPI-1 | Protein | 8e-32 | 100 |
iacP | NP_461802.1 | acyl carrier protein | Virulence | SPI-1 | Protein | 3e-31 | 99 |
iacp | YP_217800.1 | acyl carrier protein | Not tested | SPI-1 | Protein | 9e-32 | 99 |
Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
iacP | YP_008307504.1 | acyl carrier protein | VFG0542 | Protein | 8e-32 | 99 |