Gene Information

Name : iacP (SE451236_20500)
Accession : YP_008267087.1
Strain : Salmonella enterica 08-1736
Genome accession: NC_021820
Putative virulence/resistance : Virulence
Product : acyl carrier protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 4280202 - 4280450 bp
Length : 249 bp
Strand : -
Note : invasion-associated ACP; carries the fatty acid chain in fatty acid biosynthesis; Derived by automated computational analysis using gene prediction method: Protein Homology.

DNA sequence :
ATGAATATGGATATTGAAGCAAGAGTCAAAAAAGTGATCACCTCTTGTATTGCCGTTGATGTTGATAGTATCAATGGTCA
GACCCAACTGGTTGAGGATCTTTACGCTGACTCATTGGATTTAATTGATATTGTATTTGGTCTTAGTGAGGAGTTTGACA
TTAGTTGCAATGAAAACGATCTTCCTGATATGATGACCTTTGCGGATATATGCCGTGTTGTTAAAAAAAGTCTTGAGTCC
AGGGTGTAG

Protein sequence :
MNMDIEARVKKVITSCIAVDVDSINGQTQLVEDLYADSLDLIDIVFGLSEEFDISCNENDLPDMMTFADICRVVKKSLES
RV

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
iacP NP_461802.1 acyl carrier protein Virulence SPI-1 Protein 1e-31 99
sipF NP_806484.1 acyl carrier protein Virulence SPI-1 Protein 6e-31 98
sipF NP_457275.1 probable acyl carrier protein Not tested SPI-1 Protein 6e-31 98
iacp YP_217800.1 acyl carrier protein Not tested SPI-1 Protein 7e-31 97

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
iacP YP_008267087.1 acyl carrier protein VFG0542 Protein 4e-32 99