Gene Information

Name : iacP (CFSAN002050_20705)
Accession : YP_008262012.1
Strain : Salmonella enterica CFSAN002050
Genome accession: NC_021818
Putative virulence/resistance : Virulence
Product : acyl carrier protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3955266 - 3955514 bp
Length : 249 bp
Strand : -
Note : invasion-associated ACP; carries the fatty acid chain in fatty acid biosynthesis; Derived by automated computational analysis using gene prediction method: Protein Homology.

DNA sequence :
ATGAATATGGATATTGAAGCAAGAGTCAAAAAAGTGATCACCTCTTGTATTGCCGTTGATGTTGATAGTATCAATGGTCA
GACCCATCTGGTAGAGGATCTTTACGCTGACTCATTGGATTTAATTGATATTGTATTTGGTCTTAGTGAGGAGTTTGACA
TTAGTTGCAATGAAAACGATCTTCCTGATATGACGACCTTTGCGGATATATGCCGTGTTGTTAAAAAAAGTCTTGAGTCC
AGGGTGTAG

Protein sequence :
MNMDIEARVKKVITSCIAVDVDSINGQTHLVEDLYADSLDLIDIVFGLSEEFDISCNENDLPDMTTFADICRVVKKSLES
RV

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
sipF NP_457275.1 probable acyl carrier protein Not tested SPI-1 Protein 8e-32 100
sipF NP_806484.1 acyl carrier protein Virulence SPI-1 Protein 8e-32 100
iacP NP_461802.1 acyl carrier protein Virulence SPI-1 Protein 3e-31 99
iacp YP_217800.1 acyl carrier protein Not tested SPI-1 Protein 9e-32 99

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
iacP YP_008262012.1 acyl carrier protein VFG0542 Protein 8e-32 99