Gene Information

Name : G655_06350 (G655_06350)
Accession : YP_007708119.1
Strain : Pseudomonas aeruginosa B136-33
Genome accession: NC_020912
Putative virulence/resistance : Resistance
Product : Cd(II)/Pb(II)-responsive transcriptional regulator
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1366563 - 1367033 bp
Length : 471 bp
Strand : +
Note : COG0789 Predicted transcriptional regulators

DNA sequence :
ATGAAGATCGGTGAGCTGGCGAAGAGAACCGGTTGCCCGGTGGAGACCATCCGCTACTACGAGCGCGAAGGACTGTTGCC
CGAGCCCGCGCGTAGCGAAGGCAACTATCGGCAATACACCCTGGCGCACGTCGAGCGCCTGTCGTTCATCCGTCACTGCC
GCTCGCTGGACATGACCCAGGAGGAAATCCGTACCCTGCTGGCGTTGCGCGACCGTCCCGAGGCGGATTGCGGCACCGCC
AACCGGCTGATCGACGAGCACCTGCATCACGTCGAGGTGCGCATCGCCGAACTCCAGGCATTGCGCGAGCAACTGCAGGA
TCTCGGCTCACGCTGTACGGTCGCCGGCAACAGCCAGGCCTGCGGCATCCTCCGCGAACTGGAGCAGCCCGCGCCGCTGT
CGCCTATCCCCGAGGAATGCGCCGAGGCCGGGCACATGCACGTTCCCGGCGTGCACCGCCGGCATGGCTGA

Protein sequence :
MKIGELAKRTGCPVETIRYYEREGLLPEPARSEGNYRQYTLAHVERLSFIRHCRSLDMTQEEIRTLLALRDRPEADCGTA
NRLIDEHLHHVEVRIAELQALREQLQDLGSRCTVAGNSQACGILRELEQPAPLSPIPEECAEAGHMHVPGVHRRHG

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 7e-34 56
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 4e-28 47
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 4e-28 47
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 6e-28 47
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 4e-28 47
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 3e-28 47
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 3e-28 47
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 4e-28 47

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
G655_06350 YP_007708119.1 Cd(II)/Pb(II)-responsive transcriptional regulator BAC0058 Protein 2e-40 61
G655_06350 YP_007708119.1 Cd(II)/Pb(II)-responsive transcriptional regulator BAC0301 Protein 3e-32 61
G655_06350 YP_007708119.1 Cd(II)/Pb(II)-responsive transcriptional regulator BAC0462 Protein 1e-23 43