
|
Name : H681_18415 (H681_18415) Accession : YP_007659090.1 Strain : Pseudomonas denitrificans ATCC 13867 Genome accession: NC_020829 Putative virulence/resistance : Resistance Product : Cd(II)/Pb(II)-responsive transcriptional regulator Function : - COG functional category : - COG ID : - EC number : - Position : 4132628 - 4133095 bp Length : 468 bp Strand : - Note : COG0789 Predicted transcriptional regulators DNA sequence : ATGAAGATCGGTGAACTGGCGAAGCTGACCGGCTGCCCCGTGGAGACCATCCGCTACTACGAGCGCGAGGGCCTGTTGCC GGAGCCGTCGCGCAGCGAGGGCAACTACCGGCAGTACGATGCCGTCCATGTGGAGCGCCTGTCGTTCATCCGCCATTGCC GCTCGCTGGACATGACCCAGGAGGAAATCCGCATCCTGCTGGGCCTGCGTGACCGCCCCGAGTCCGATTGCGGTACCGCC AACCGGCTGATCGACGAACACCTGCACCACGTCGAGGTGCGGATTGCCGAGTTGCAGTCGCTCAGCCAGCAACTGCGTGA CTTGCGCGCTCGGTGTCGCGGTGAGGGCAACAGCGAGGACTGCGGCATCCTGCGCGAACTGGAGCAGCCGGCGGAGCCGT CGGTGGTTCCCGAGGTCTGCGCGGAGGCGGGGCACCTGCACGTGCCAGGCGTCCACGGCCGACACTGA Protein sequence : MKIGELAKLTGCPVETIRYYEREGLLPEPSRSEGNYRQYDAVHVERLSFIRHCRSLDMTQEEIRILLGLRDRPESDCGTA NRLIDEHLHHVEVRIAELQSLSQQLRDLRARCRGEGNSEDCGILRELEQPAEPSVVPEVCAEAGHLHVPGVHGRH |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| ORF C98 | AAN62191.1 | putative transcriptional regulator | Not tested | PAGI-2(C) | Protein | 8e-32 | 56 |
| ACICU_00234 | YP_001844893.1 | transcriptional regulator | Not tested | AbaR20 | Protein | 4e-25 | 47 |
| pbrR | CAJ77094.1 | Transcriptional regulator | Not tested | AbaR1 | Protein | 3e-25 | 47 |
| cadR | AGK36653.1 | MerR family transcriptional regulator | Not tested | AbaR26 | Protein | 3e-25 | 47 |
| cadR | ACN81029.1 | MerR family transcriptional regulator | Not tested | AbaR5 | Protein | 4e-25 | 47 |
| cadR | ADZ05769.1 | MerR family transcriptional regulator | Not tested | AbaR11 | Protein | 6e-25 | 46 |
| cadR | ACS32041.1 | MerR family transcriptional regulator | Not tested | AbaR5 | Protein | 9e-25 | 46 |
| pbrR | CAJ77021.1 | transcription regulator | Not tested | AbaR1 | Protein | 6e-25 | 46 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| H681_18415 | YP_007659090.1 | Cd(II)/Pb(II)-responsive transcriptional regulator | BAC0301 | Protein | 4e-30 | 61 |
| H681_18415 | YP_007659090.1 | Cd(II)/Pb(II)-responsive transcriptional regulator | BAC0058 | Protein | 2e-37 | 58 |
| H681_18415 | YP_007659090.1 | Cd(II)/Pb(II)-responsive transcriptional regulator | BAC0462 | Protein | 2e-20 | 44 |