Gene Information

Name : G432_03575 (G432_03575)
Accession : YP_007615038.1
Strain : Sphingomonas sp. MM-1
Genome accession: NC_020561
Putative virulence/resistance : Resistance
Product : MerR family transcriptional regulator
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 750532 - 750933 bp
Length : 402 bp
Strand : -
Note : COG0789 Predicted transcriptional regulators

DNA sequence :
ATGCTGACGATCGGCGAGCTGGGCAGGGCGACCGAGACCGGGGTCGAGACCATCCGTTATTATGAGCGGATCGGATTGCT
GCCCCGGCCATCGCGGACCGGCGGCAATTATCGCGCTTATGGCGAGGCCGATCTAGGCCGCCTTTCGTTCATCCGCCGGG
CGCGTGCCCTGGGCTTCCCGCTCGATCGGGTGCGCGCCCTGCTGTCGCTGTCGGACGATCGCGGCCGCGACTGCGCGACC
ATCGACCTGCTGGCGCGGGAGCATCTGGCCGAGGTGGAGCGCAAGATCGCGGATCTGGCGGCGCTTCGGCGCGAGCTGGC
GGCAATGATCGATTCCTGCGGCGGCGGCACGGTGGCGCAGTGCCGGATCGTCGAGGCGCTGGGGCCGGCCCGGCGCGATT
GA

Protein sequence :
MLTIGELGRATETGVETIRYYERIGLLPRPSRTGGNYRAYGEADLGRLSFIRRARALGFPLDRVRALLSLSDDRGRDCAT
IDLLAREHLAEVERKIADLAALRRELAAMIDSCGGGTVAQCRIVEALGPARRD

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 2e-19 42
merR AAN62181.1 organomercurial resistance regulatory protein MerR Not tested PAGI-2(C) Protein 2e-16 42
unnamed ABR13397.1 mercuric resistance operon regulatory protein Not tested PAGI-5 Protein 4e-19 41
merR YP_006098391.1 mercuric resistance operon transcriptional regulator Not tested Tn2411 Protein 2e-15 41
merR AGK07025.1 MerR Not tested SGI1 Protein 3e-15 41
merR AGK07083.1 MerR Not tested SGI1 Protein 3e-15 41
merR ACK44535.1 MerR Not tested SGI1 Protein 1e-15 41
merR AET25401.1 MerR Not tested PAGI-2(C) Protein 1e-15 41
merR AFG30124.1 MerR Not tested PAGI-2 Protein 1e-15 41
EXB37 ABD94723.1 putative regulator of mercury resistance conferring proteins Not tested ExoU island B Protein 1e-19 41

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0058 Protein 1e-22 43
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0462 Protein 5e-20 42
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0683 Protein 6e-17 42
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0301 Protein 3e-20 42
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0232 Protein 9e-16 41
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0684 Protein 1e-16 41
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0687 Protein 9e-16 41
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0688 Protein 8e-17 41
G432_03575 YP_007615038.1 MerR family transcriptional regulator BAC0190 Protein 2e-24 41