Gene Information

Name : BN419_2802 (BN419_2802)
Accession : -
Strain : Listeria monocytogenes N53-1
Genome accession: NC_020558
Putative virulence/resistance : Unknown
Product : tRNA-Leu
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2287241 - 2287324 bp
Length : 84 bp
Strand : +
Note : Predicted by tRNAscan-SE software with a score of 65.94

DNA sequence :
TACCGGCGGCCGGGGTCGAACCGGCACGCCCTTGCGGGCACAGGATTTTGAGTCCAGCGCGTCTGCCAATTCCGCCACGC
CGGC

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
trnL - tRNA-Leu Not tested FWisland_5 DNA 9e-39 96.4
tRNA-Leu - tRNA-Leu Not tested Not named DNA 9e-39 96.4