Gene Information

Name : BN419_0250 (BN419_0250)
Accession : -
Strain : Listeria monocytogenes N53-1
Genome accession: NC_020558
Putative virulence/resistance : Unknown
Product : tRNA-Thr
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 229244 - 229319 bp
Length : 76 bp
Strand : +
Note : Predicted by tRNAscan-SE software with a score of 95.38

DNA sequence :
GCCGGCTTAGCTCAGTTGGTAGAGCAACTGATTTGTAATCAGTAGGTCGCGAGTTCGACTCTTGCAGCCGGCACCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
BJAB07104_tRNA9 - tRNA-Thr Not tested AbaR25 DNA 3e-19 91.4
BJAB0868_tRNA9 - tRNA-Thr Not tested AbaR26 DNA 3e-19 91.4