Gene Information

Name : BN419_1459 (BN419_1459)
Accession : -
Strain : Listeria monocytogenes N53-1
Genome accession: NC_020558
Putative virulence/resistance : Unknown
Product : tRNA-Arg
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1164453 - 1164526 bp
Length : 74 bp
Strand : +
Note : Predicted by tRNAscan-SE software with a score of 82.37

DNA sequence :
GTCCTGATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGGGTTCGAATCCCTCTCAGGACG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
tRNA-Arg - tRNA-Arg Not tested LIPI-2 DNA 3e-35 100
SAVtRNA16 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
SACOL_tRNA-Arg-2 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
MWtRNA16 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
SAUSA300_1066 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
SAtRNA18 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
SAKOR_r020 - tRNA-Arg Not tested vSa¥ã DNA 4e-32 94.6
SERP_tRNA-Arg-3 - tRNA-Arg Not tested vSe¥ã DNA 4e-32 94.6
SEt06 - tRNA-Arg Not tested vSe¥ã DNA 4e-32 94.6
EFAU085_t001 - tRNA-Arg Not tested Not named DNA 7e-21 93.2