Name : BN418_2792 (BN418_2792) Accession : - Strain : Listeria monocytogenes La111 Genome accession: NC_020557 Putative virulence/resistance : Unknown Product : tRNA-Leu Function : - COG functional category : - COG ID : - EC number : - Position : 2286841 - 2286924 bp Length : 84 bp Strand : + Note : Predicted by tRNAscan-SE software with a score of 65.94 DNA sequence : TACCGGCGGCCGGGGTCGAACCGGCACGCCCTTGCGGGCACAGGATTTTGAGTCCAGCGCGTCTGCCAATTCCGCCACGC CGGC Protein sequence : - |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
trnL | - | tRNA-Leu | Not tested | FWisland_5 | DNA | 9e-39 | 96.4 |
tRNA-Leu | - | tRNA-Leu | Not tested | Not named | DNA | 9e-39 | 96.4 |