Gene Information

Name : R2APBS1_1521 (R2APBS1_1521)
Accession : YP_007589899.1
Strain : Rhodanobacter sp. 2APBS1
Genome accession: NC_020541
Putative virulence/resistance : Resistance
Product : glutaredoxin-dependent arsenate reductase
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1656758 - 1657102 bp
Length : 345 bp
Strand : -
Note : PFAM: ArsC family; TIGRFAM: arsenate reductase (glutaredoxin)

DNA sequence : 
ATGCTGCGCATCTATCACAACAACCGCTGCTCCAAGTCGCGCGCCACGCTCGCGCTGCTGGAACAGCACGGCGGCAAGGT
CGAGGTGATCAACTACCTCGACACGCCGCCGAGCGCCGCCGAACTGGCCGTGTTGCTGCGGCAACTGGGCATGACCGCGC
GCGAACTGCTGCGCACCGGCGAGGAGGAGTACCGCTCGCTGGGGCTGGACGATCCCGCCCTCGACGAGGGTGCACTGATC
GCCGCGATGGTGGCGCACCCGAAGCTGATCGAACGCCCGATCGTGGTCGCCAACGGCAAGGCCGTCATCGGCCGCCCACC
GGAAGCGGTGCTGGCGATACTCTGA

Protein sequence : 
MLRIYHNNRCSKSRATLALLEQHGGKVEVINYLDTPPSAAELAVLLRQLGMTARELLRTGEEEYRSLGLDDPALDEGALI
AAMVAHPKLIERPIVVANGKAVIGRPPEAVLAIL

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
arsC2 YP_001007634.1 arsenate reductase Not tested YAPI Protein 2e-19 45
arsC ADZ05768.1 arsenate reductase Not tested AbaR11 Protein 4e-18 43

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
R2APBS1_1521 YP_007589899.1 glutaredoxin-dependent arsenate reductase BAC0585 Protein 9e-22 45
R2APBS1_1521 YP_007589899.1 glutaredoxin-dependent arsenate reductase BAC0583 Protein 2e-20 45
R2APBS1_1521 YP_007589899.1 glutaredoxin-dependent arsenate reductase BAC0584 Protein 2e-21 44
R2APBS1_1521 YP_007589899.1 glutaredoxin-dependent arsenate reductase BAC0582 Protein 3e-20 43