
|
Name : yrkD (BSU6051_26550) Accession : YP_007534637.1 Strain : Bacillus subtilis 6051-HGW Genome accession: NC_020507 Putative virulence/resistance : Unknown Product : YrkD Function : - COG functional category : - COG ID : - EC number : - Position : 2713932 - 2714123 bp Length : 192 bp Strand : - Note : Evidence 4: Homologs of previously reported genes of unknown function DNA sequence : ATGATGGAACAAGGAAAAGATTGTAGAGAGGTTGTGACCCAATTAGCAGCTTCCCGTAATGCGATCGATCGAGCGATGGG TTTAATTGTGAGCACAAACCTTGAACATTGTGTTCGTGAAAGTTTAGAAAAAGGCGAAGACACACAAAATTTAGTAAAAG AAGCAGTCGACTTATTGGTAAAGAGCCGATAA Protein sequence : MMEQGKDCREVVTQLAASRNAIDRAMGLIVSTNLEHCVRESLEKGEDTQNLVKEAVDLLVKSR |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| unnamed | BAB83476.1 | - | Not tested | SCC 12263 | Protein | 6e-14 | 54 |
| unnamed | BAA94324.1 | hypothetical protein | Not tested | Type-I SCCmec | Protein | 5e-14 | 53 |
| unnamed | BAA82210.2 | - | Not tested | Type-II SCCmec | Protein | 5e-14 | 53 |
| SAV0048 | NP_370572.1 | hypothetical protein | Not tested | Type-II SCCmec | Protein | 7e-14 | 53 |
| SA0045 | NP_373285.1 | hypothetical protein | Not tested | Type-II SCCmec | Protein | 7e-14 | 53 |
| SERP2514 | YP_190056.1 | hypothetical protein | Not tested | Type-II SCCmec | Protein | 7e-14 | 53 |
| SACOL0048 | YP_184958.1 | hypothetical protein | Not tested | Type-I SCCmec | Protein | 7e-14 | 53 |
| unnamed | BAC57484.1 | hypothetical protein | Not tested | Type-IIIinv SCCmec | Protein | 5e-14 | 53 |
| SAPIG0063 | YP_005732873.1 | conserved protein YrkD | Not tested | Type-V SCCmec | Protein | 1e-13 | 53 |
| unnamed | BAB47614.1 | hypothetical protein | Not tested | Type-III SCCmec | Protein | 5e-14 | 53 |
| SAR0047 | YP_039520.1 | hypothetical protein | Not tested | Type-II SCCmec | Protein | 7e-14 | 53 |
| unnamed | BAA82170.2 | - | Not tested | Type-II SCCmec | Protein | 9e-14 | 51 |
| unnamed | BAA86632.1 | hypothetical protein | Not tested | Type-I SCCmec | Protein | 4e-14 | 51 |