Gene Information

Name : EC042_4581A (EC042_4581A)
Accession : YP_006098853.1
Strain : Escherichia coli 042
Genome accession: NC_017626
Putative virulence/resistance : Unknown
Product : transposase (partial)
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 4915245 - 4915313 bp
Length : 69 bp
Strand : +
Note : Note this CDS carries a frameshift mutation, a premature stop codon and lacks the very C-terminus.

DNA sequence :
ATGACTAAAAATACTCGTTTTTCCCCCGAAGTTCGTCATAGGGTGATTCGTATAGTTCTGGAAAGTCAG

Protein sequence :
MTKNTRFSPEVRHRVIRIVLESQGEYDSWAIICSIAPKIGCTPETLRVWGRQHERDTGGGDGGLTTAERQRLKELERENR
ELRRSNDILRQAS

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
IS629 CAI43841.1 hypothetical protein Not tested LEE Protein 8e-19 92
Z4335 NP_289560.1 hypothetical protein Not tested OI-122 Protein 2e-18 92
IS629 CAI43908.1 hypothetical protein 1 Not tested LEE Protein 8e-19 92
ECO103_3584 YP_003223442.1 IS629 transposase OrfA Not tested LEE Protein 1e-18 92
Z1199 NP_286734.1 hypothetical protein Not tested TAI Protein 4e-19 92
Z1222 NP_286757.1 hypothetical protein Not tested TAI Protein 4e-19 92
Z1639 NP_287142.1 hypothetical protein Not tested TAI Protein 4e-19 92
Z1661 NP_287163.1 hypothetical protein Not tested TAI Protein 4e-19 92
IS629 CAC37925.1 hypothetical protein Not tested LEE Protein 8e-19 92
ECO111_3720 YP_003236060.1 putative IS629 transposase OrfA Not tested LEE Protein 2e-18 92
IS629 CAI43820.1 hypothetical protein Not tested LEE Protein 8e-19 92
ECO111_3775 YP_003236110.1 putative IS629 transposase OrfA Not tested LEE Protein 2e-18 92