Gene Information

Name : NCGM2_5574 (NCGM2_5574)
Accession : YP_005983771.1
Strain : Pseudomonas aeruginosa NCGM2.S1
Genome accession: NC_017549
Putative virulence/resistance : Unknown
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 5953548 - 5953748 bp
Length : 201 bp
Strand : -
Note : similar to GI:116054340; similar to PA14_07970 of P. aeruginosa UCBPP-PA14

DNA sequence :
ATGGCTGACCTTGCCGATCACGCCAACGAACTGGTCCTGGCTCGCCTCGACGGCCTCCTGGCGGCGCGCCCGGCGCTGGC
CATCCGCGAGTCCGCGGAAGACTGCGAGGACTGCGGCGAGCCCATTCCCCAGGCGCGCCGTCGGGCGGCACCGGGTTGCA
GTCGCTGCATCGACTGCCAGGACCGCCACGAGCGCCGTTGA

Protein sequence :
MADLADHANELVLARLDGLLAARPALAIRESAEDCEDCGEPIPQARRRAAPGCSRCIDCQDRHERR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed ABR13500.1 hypothetical protein Not tested PAGI-6 Protein 2e-06 51