|
Name : rpmE2 (STM14_0553) Accession : YP_005236166.1 Strain : Salmonella enterica 14028S Genome accession: NC_016856 Putative virulence/resistance : Unknown Product : 50S ribosomal protein L31 Function : - COG functional category : - COG ID : - EC number : - Position : 527046 - 527306 bp Length : 261 bp Strand : + Note : RpmE2; there appears to be two types of ribosomal proteins L31 in bacterial genomes; some contain a CxxC motif while others do not; Bacillus subtilis has both types; the proteins in this cluster do not have the CXXC motif; RpmE is found in exponentially g DNA sequence : ATGAAACCTGATATTCATCCTGTATACCGCACCGTCGTATTTCACGACACCAGCGCAAATGAATATGTGAAAGTGGGATC AACTATCAAAACTGAACGTGAAATCGAACTGGACGGCGTGACATATCCGTATGTCACTATTGATGTGTCATCAAAATCGC ATCCTTTTTATACCGGTAGACAGAAAACGTTTGATAGCGAAAGTAGCGCCGCACGCTTCCAGAAACGTTTCGGTCATTTT ATCGGCGCTAAACGGGGGTAA Protein sequence : MKPDIHPVYRTVVFHDTSANEYVKVGSTIKTEREIELDGVTYPYVTIDVSSKSHPFYTGRQKTFDSESSAARFQKRFGHF IGAKRG |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| rpmE2 | NP_286687.1 | 50S ribosomal protein L31 | Not tested | TAI | Protein | 3e-27 | 74 |
| rpmE2 | NP_287095.1 | 50S ribosomal protein L31 | Not tested | TAI | Protein | 3e-27 | 74 |
