
|
Name : Pmu_02670 (Pmu_02670) Accession : - Strain : Pasteurella multocida 36950 Genome accession: NC_016808 Putative virulence/resistance : Unknown Product : - Function : - COG functional category : - COG ID : - EC number : - Position : 273230 - 273283 bp Length : 54 bp Strand : - Note : tRNA-Leu; gene disrupted by the insertion of an integrative and conjugative element (ICE) DNA sequence : TTGATTCAAAATCAACCGCCTTCGGGTGTGCCGGTTCGAGTCCGGCCCTAGGCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| Pmu_02670 | - | - | Not tested | ICEPmu1 | DNA | 3e-23 | 100 |