Gene Information

Name : KOX_09555 (KOX_09555)
Accession : YP_005017876.1
Strain : Klebsiella oxytoca KCTC 1686
Genome accession: NC_016612
Putative virulence/resistance : Virulence
Product : putative regulatory protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2040356 - 2040562 bp
Length : 207 bp
Strand : -
Note : COG3311 Predicted transcriptional regulator

DNA sequence : 
TTGGATTCAAATTCAGTATTGAATGATCAGCTTGTCGACATGGCATTTATCACTGCCTACACCAATATGACCGACAAATG
GTTCTATAGATTAATTTCTGAAAATTCGTTCCCAGCACCAATTAAACTTGGCCGAAGTTCTCGTTGGCTAAAAAGTGAAG
TAGAGGCCTGGATGACAGAACGGATTAAAAACTCAAGAGGACTATAA

Protein sequence : 
MDSNSVLNDQLVDMAFITAYTNMTDKWFYRLISENSFPAPIKLGRSSRWLKSEVEAWMTERIKNSRGL

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed CAE85187.1 hypothetical protein Not tested PAI V 536 Protein 1e-18 71
ECO103_3577 YP_003223438.1 transcriptional regulator Not tested LEE Protein 2e-18 71
unnamed CAD33739.1 hypothetical protein Not tested PAI I 536 Protein 2e-18 70
c5192 NP_757040.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-18 70
Z1188 NP_286723.1 hypothetical protein Not tested TAI Protein 1e-14 70
Z1627 NP_287131.1 hypothetical protein Not tested TAI Protein 1e-14 70
rox AAR97599.1 regulator of excision Not tested SHI-1 Protein 4e-18 68
S3190 NP_838473.1 hypothetical protein Not tested SHI-1 Protein 5e-18 68
SF2987 NP_708761.1 hypothetical protein Not tested SHI-1 Protein 5e-18 68
unnamed CAI43835.1 hypothetical protein Not tested LEE Protein 4e-18 66
unnamed ADD91712.1 putative transcriptional regulator AlpA Not tested PAI-I AL862 Protein 4e-18 66

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
KOX_09555 YP_005017876.1 putative regulatory protein VFG1480 Protein 7e-19 70
KOX_09555 YP_005017876.1 putative regulatory protein VFG0651 Protein 1e-18 68