Gene Information

Name : tRNA_024 (tRNA_024)
Accession : -
Strain : Zobellia galactanivorans DsiJT
Genome accession: NC_015844
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2735409 - 2735499 bp
Length : 91 bp
Strand : +
Note : Gene encoding for a Serine tRNA with the anticodon sequence GGA (35-37); tRNA is the information adapter molecule. It is the direct interface between amino-acid sequence of a protein and the information in DNA. All have between 75-95 nucleotides; The amin

DNA sequence :
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACACCAAAAGTGTATCGAGGGTTCGAATCCCTT
CCTCTCTGCGA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAVtRNA17 - tRNA-Ser Not tested vSa¥â DNA 3e-21 88.4
SAMSHR1132_t09 - tRNA-Ser Not tested vSa¥â DNA 3e-21 88.4
SAtRNA19 - tRNA-Ser Not tested vSa¥â DNA 3e-21 88.4
SEt07 - tRNA-Ser Not tested vSe2 DNA 2e-20 87