|
Name : tRNA_024 (tRNA_024) Accession : - Strain : Zobellia galactanivorans DsiJT Genome accession: NC_015844 Putative virulence/resistance : Unknown Product : tRNA-Ser Function : - COG functional category : - COG ID : - EC number : - Position : 2735409 - 2735499 bp Length : 91 bp Strand : + Note : Gene encoding for a Serine tRNA with the anticodon sequence GGA (35-37); tRNA is the information adapter molecule. It is the direct interface between amino-acid sequence of a protein and the information in DNA. All have between 75-95 nucleotides; The amin DNA sequence : AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACACCAAAAGTGTATCGAGGGTTCGAATCCCTT CCTCTCTGCGA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| SAMSHR1132_t09 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 3e-21 | 88.4 |
| SAtRNA19 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 3e-21 | 88.4 |
| SAVtRNA17 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 3e-21 | 88.4 |
| SEt07 | - | tRNA-Ser | Not tested | vSe2 | DNA | 2e-20 | 87 |
