
|
Name : Psefu_2233 (Psefu_2233) Accession : YP_004474294.1 Strain : Pseudomonas fulva 12-X Genome accession: NC_015556 Putative virulence/resistance : Resistance Product : MerR family transcriptional regulator Function : - COG functional category : K : Transcription COG ID : COG0789 EC number : - Position : 2393974 - 2394420 bp Length : 447 bp Strand : + Note : TIGRFAM: Cd(II)/Pb(II)-responsive transcriptional regulator; PFAM: transcription regulator MerR, DNA binding; HTH transcriptional regulator, MerR; KEGG: psa:PST_0663 transcriptional regulator CadR; SMART: HTH transcriptional regulator, MerR DNA sequence : ATGAAAATTGGTGAATTGGCGACGGTGACTGGCTGCCAGGTGGAAACCATCCGCTATTACGAGCGTGAAGGATTGCTGCC CGCACCCCAGCGTAGCGAAGGCAATTACCGCCTTTACCTGCCGGAGCACGTCGAGCGGCTTACCTTCATCCGCAATTGCC GCACCCTGGACATGACGCTCGACGAGATTCGCGAGCTGCTCAGCCTGCGCGGCCGTCCGGCAGAAAACTGCGAAGCCATC AACACGCTGATCGACGAGCATATCGAGCACGTCAACGCGCGAATCGCCAGCCTGCAGTCGCTGCAGGAGCAACTGGTCGA GCTGCGCAACAGCTGCCTGGCGGATCAGCAATCATCGCCGTGCGAGATCATCCGGCAACTCAGTACCAGCGATACGCTGC ACGCCGAGAAGGATGTTTCTCATGTCGGCCGGGCGCATCGGCATTGA Protein sequence : MKIGELATVTGCQVETIRYYEREGLLPAPQRSEGNYRLYLPEHVERLTFIRNCRTLDMTLDEIRELLSLRGRPAENCEAI NTLIDEHIEHVNARIASLQSLQEQLVELRNSCLADQQSSPCEIIRQLSTSDTLHAEKDVSHVGRAHRH |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| ORF C98 | AAN62191.1 | putative transcriptional regulator | Not tested | PAGI-2(C) | Protein | 9e-29 | 50 |
| ACICU_00234 | YP_001844893.1 | transcriptional regulator | Not tested | AbaR20 | Protein | 1e-26 | 47 |
| cadR | ACS32041.1 | MerR family transcriptional regulator | Not tested | AbaR5 | Protein | 9e-27 | 47 |
| cadR | ADZ05769.1 | MerR family transcriptional regulator | Not tested | AbaR11 | Protein | 6e-27 | 47 |
| cadR | ACN81029.1 | MerR family transcriptional regulator | Not tested | AbaR5 | Protein | 9e-27 | 47 |
| pbrR | CAJ77094.1 | Transcriptional regulator | Not tested | AbaR1 | Protein | 6e-27 | 47 |
| cadR | AGK36653.1 | MerR family transcriptional regulator | Not tested | AbaR26 | Protein | 6e-27 | 47 |
| pbrR | CAJ77021.1 | transcription regulator | Not tested | AbaR1 | Protein | 6e-27 | 47 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| Psefu_2233 | YP_004474294.1 | MerR family transcriptional regulator | BAC0058 | Protein | 3e-39 | 66 |
| Psefu_2233 | YP_004474294.1 | MerR family transcriptional regulator | BAC0301 | Protein | 4e-32 | 55 |