Gene Information

Name : ACMV_26490 (ACMV_26490)
Accession : YP_004284878.1
Strain : Acidiphilium multivorum AIU301
Genome accession: NC_015186
Putative virulence/resistance : Resistance
Product : MerR family transcriptional regulator
Function : -
COG functional category : K : Transcription
COG ID : COG0789
EC number : -
Position : 2909952 - 2910350 bp
Length : 399 bp
Strand : +
Note : -

DNA sequence :
ATGATCCTGATTGGCGCGCTAGCCACGCAAACGCGGTGCAATATCGAGACGATCCGGTTCTACGAGAAGATTGGCGTGTT
GCCAAAACCGGCGCGCACCGAGGGCGGCCATCGAATGTATGGCCCCGCCCACGTCAAGCGCCTCAGCTTCATCCGCCGCG
CGCGTGAACTCGGCTTCACGCTCGACGAGGTGCGCGCTTTGCTGCGCCTGGCAGACGAGCGCGATCGCCCCTGCGGCGAG
GTAAAATTGGTCGCCGAGGCTCATCTCGCGGAAGTGCGGATCAAAATCACCGATCTGCGCGCCATGCAAAAGGCGCTGAC
CACTTTGGTCACGCAATGCGACGCCGGCGACGGAACCGATTGTGCGCTCCTCGAAGCCCTATTACGTCAGCGAACCTGA

Protein sequence :
MILIGALATQTRCNIETIRFYEKIGVLPKPARTEGGHRMYGPAHVKRLSFIRRARELGFTLDEVRALLRLADERDRPCGE
VKLVAEAHLAEVRIKITDLRAMQKALTTLVTQCDAGDGTDCALLEALLRQRT

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
merR AAN62181.1 organomercurial resistance regulatory protein MerR Not tested PAGI-2(C) Protein 2e-19 46
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 2e-23 45
EXB37 ABD94723.1 putative regulator of mercury resistance conferring proteins Not tested ExoU island B Protein 1e-20 43
unnamed ABR13397.1 mercuric resistance operon regulatory protein Not tested PAGI-5 Protein 5e-19 42
merR CAJ77064.1 Mercury resistance operon regulatory protein Not tested AbaR1 Protein 2e-17 41
merR ACN81009.1 MerR activator/repressor of mer operon Not tested AbaR5 Protein 4e-17 41

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
ACMV_26490 YP_004284878.1 MerR family transcriptional regulator BAC0058 Protein 2e-23 48
ACMV_26490 YP_004284878.1 MerR family transcriptional regulator BAC0301 Protein 2e-18 44
ACMV_26490 YP_004284878.1 MerR family transcriptional regulator BAC0688 Protein 4e-18 42
ACMV_26490 YP_004284878.1 MerR family transcriptional regulator BAC0686 Protein 1e-18 41