Gene Information

Name : Pat9b_5038 (Pat9b_5038)
Accession : -
Strain :
Genome accession: NC_014839
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 319270 - 319936 bp
Length : 667 bp
Strand : -
Note : -

DNA sequence :
TTGCTGACGGAGCAGCACATAAACCCATTCAAAGGCCGGCGTTTTCAGCGTGACATCAGCCTTTTGGCGGTAGGCTGGTA
CTGCAAATACGGCATCAGCTACCGTGAGCTACAGGAGATGCTGCCTGAGCGAGCGGTGAGGTGAATGTCGCACACTCGAC
CATCTACCGCTGGGTTCAGCGTTACGCTCAAGAAATGAAAAAAGGCTGCGCTGGTACTGGCGTAACTCTTCCGATATTTG
CCCGTGGCACGCTGACGAAACTTACCTGAAGGTCAATGGCCGCAGGGCTTATCTTTACCGGGCCGTCGGAAGAAGGGACC
GCACTGTCGATTTTTATATCTCACCACGTCGTAACAACAAAGCCGCATATCGGTTACTGGCTAAAATCCTCAATAACGTG
AAGAAGTGGCAGGTCCCGCCATTTAATAACACGGATAAAGCACCTACCTATGGTCGTGCACTCACTCTGCTCAAATGCGA
AAGCAGATCTCCACTTGACGTTGAGCTCAGACAGATTAACTACCTGAATAACGTCATTGAATGCGACCATGGCAAGCTGA
AAAGGATCGAGGTGATGCGTGCAATCCGTAAAGGCCAGGCTTCAACATTTTATTATATTGATTCCCTATGCGAGGTGCAT
CTGGTGAGCAGAATCTTTGAAATGTAG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ABTW07_3892 YP_005797140.1 transposase IS26 Not tested AbaR4e DNA e-139 86.8
ABTW07_3877 YP_005797125.1 transposase IS26 Not tested AbaR4e DNA e-139 86.8
IS15 CAJ77077.1 Insertion sequence Not tested AbaR1 DNA e-138 86.6
IS26 CAJ77074.1 Insertion sequence Not tested AbaR1 DNA e-171 85.9
unnamed AEZ06025.1 TnpA26, Transposase of IS26 Not tested AbaR24 DNA e-171 85.8
tnp7109-28 YP_001800928.1 transposase for insertion sequence Not tested Not named DNA e-171 85.8
tnp7109-29 YP_001800930.1 transposase for insertion sequence Not tested Not named DNA e-171 85.8
tnpA26 AGK07095.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
tpnIS26 ADZ05788.1 transposase Not tested AbaR15 DNA e-171 85.8
tnpA26 ACN81018.1 transposase of IS26 Not tested AbaR5 DNA e-171 85.8
tnpA26 AGK07097.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
tnpA AET25383.1 TnpA Not tested PAGI-2(C) DNA e-171 85.8
unnamed - - Not tested AbaR15 DNA e-171 85.8
tnpA AFG30106.1 TnpA Not tested PAGI-2 DNA e-171 85.8
tnpA26 ACN81013.1 transposase of IS26 Not tested AbaR5 DNA e-171 85.8
tnpA26 AFV53110.1 transposase of IS26 Not tested AbGRI2-1 DNA e-171 85.8
tnpA26 AFV53107.1 transposase of IS26 Not tested AbGRI2-1 DNA e-171 85.8
tnpA26 AGK07034.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
tnpA26 ACK44541.1 TnpA Not tested SGI1 DNA e-171 85.8
tnpA26 AFV53122.1 transposase of IS26 Not tested AbGRI2-1 DNA e-171 85.8
tnpA26 AGK07037.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
tnpA26 ACK44543.1 TnpA Not tested SGI1 DNA e-171 85.8
tnpA26 AFV53108.1 transposase of IS26 Not tested AbGRI2-1 DNA e-171 85.8
tnpA26 AGK07039.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
tpnIS26 ADZ05800.1 transposase Not tested AbaR19 DNA e-171 85.8
tnpA26 AGK07092.1 IS26 transposase Not tested SGI1 DNA e-171 85.8
unnamed - - Not tested AbaR19 DNA e-171 85.8
unnamed - - Not tested AbaR12 DNA e-170 85.7
tpnIS26 ADZ05778.1 transposase Not tested AbaR12 DNA e-170 85.6
tpnIS26 ADZ05794.1 transposase Not tested AbaR16 DNA e-170 85.6
unnamed - - Not tested AbaR16 DNA e-170 85.6
tnp26 AGK36639.1 transposase of IS26 Not tested AbaR26 DNA e-170 85.6
tpnIS26 ADZ05810.1 transposase Not tested AbaR20 DNA e-170 85.6
tnpA26 ACN81016.1 transposase of IS26 Not tested AbaR5 DNA e-170 85.6
tnpA26 AFV53109.1 transposase of IS26 Not tested AbGRI2-1 DNA e-170 85.6
tnpA26 ACV89829.1 transposase of IS26 Not tested AbaR6 DNA e-170 85.6
tnpA26 ACV89831.1 transposase of IS26 Not tested AbaR7 DNA e-170 85.6
tpnIS26 ADZ05796.1 transposase Not tested AbaR17 DNA e-170 85.6
tnpA26 ADK35781.1 transposase of IS26 Not tested AbaR8 DNA e-170 85.6
tpnIS26 ADZ05798.1 transposase Not tested AbaR18 DNA e-170 85.6
Pmu_03450 YP_005176243.1 IS26 transposase Not tested ICEPmu1 DNA e-170 85.6
Pmu_03480 YP_005176246.1 IS26 transposase Not tested ICEPmu1 DNA e-170 85.6
tnp26 AGK36641.1 transposase of IS26 Not tested AbaR26 DNA e-170 85.6
tpnIS26 ADZ05784.1 transposase Not tested AbaR14 DNA e-170 85.5
ABTW07_3872 YP_005797120.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA e-171 85
ABTW07_3875 YP_005797123.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA e-171 85
ABTW07_3890 YP_005797138.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA e-171 85
ABTW07_3906 YP_005797154.1 transposase of IS15DI, IS6 family Not tested AbaR4e DNA e-171 85
unnamed - - Not tested AbaR26 DNA e-170 85
IS26 CAJ77078.1 Insertion sequence Not tested AbaR1 DNA e-170 84.9
IS26 CAJ77080.1 Insertion sequence Not tested AbaR1 DNA e-163 84.2