|
Name : merP (NIDE0066) Accession : YP_003795782.1 Strain : Candidatus Nitrospira defluvii Genome accession: NC_014355 Putative virulence/resistance : Resistance Product : periplasmic mercury ion binding protein Function : - COG functional category : P : Inorganic ion transport and metabolism COG ID : COG2608 EC number : - Position : 55641 - 55925 bp Length : 285 bp Strand : + Note : Evidence 2b : Function of strongly homologous gene; PubMedId : 15123428, 1555597, 2666393, 9167257, 9188683, 9649312; Product type t : transporter DNA sequence : GTGAAAAAACTCGTTGCCCTGGCGGCGTTGGCCGCGATGACCTCGCCCGTCTGGGCTGCCACCCAGAGCGTCACGCTGTC CGTGCCGGGCATGAACTGCGCCACTTGCCCGATCACGGTCAAGAAAGCGCTGACCAAGGTTTCCGGCGTCAGCAAGATCG ACGTGAGCCTGGATCGACGTGAGGCCAGGGTCACGTTCGATGATGCGAAGGCGAACGTCGAGGCCCTCACACGCGCCACC AAGGACGCAGGTTTTCCGTCCACTTTGGTGGGAGCCGCCAAATGA Protein sequence : MKKLVALAALAAMTSPVWAATQSVTLSVPGMNCATCPITVKKALTKVSGVSKIDVSLDRREARVTFDDAKANVEALTRAT KDAGFPSTLVGAAK |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| merP | CAJ77062.1 | Periplasmic mercuric ion binding protein | Not tested | AbaR1 | Protein | 2e-20 | 74 |
| merP | ACN81007.1 | MerP periplasmic mercuric ion binding protein | Not tested | AbaR5 | Protein | 2e-20 | 74 |
| merP | YP_006098389.1 | mercuric ion transport protein | Not tested | Tn2411 | Protein | 1e-20 | 70 |
| merP | ABQ57373.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| merP | AET25399.1 | MerP | Not tested | PAGI-2(C) | Protein | 8e-21 | 70 |
| merP | AFG30122.1 | MerP | Not tested | PAGI-2 | Protein | 8e-21 | 70 |
| merP | AGK07023.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| merP | AGK07081.1 | MerP | Not tested | SGI1 | Protein | 8e-21 | 70 |
| unnamed | ABR13399.1 | copper-transporting ATPase 2 | Not tested | PAGI-5 | Protein | 5e-23 | 69 |
| merP | AAN62179.1 | periplasmic mercuric ion binding protein MerP | Not tested | PAGI-2(C) | Protein | 4e-19 | 66 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| merP | YP_003795782.1 | periplasmic mercury ion binding protein | BAC0679 | Protein | 1e-19 | 70 |
| merP | YP_003795782.1 | periplasmic mercury ion binding protein | BAC0678 | Protein | 3e-20 | 68 |
| merP | YP_003795782.1 | periplasmic mercury ion binding protein | BAC0675 | Protein | 4e-19 | 68 |
| merP | YP_003795782.1 | periplasmic mercury ion binding protein | BAC0231 | Protein | 2e-20 | 67 |
| merP | YP_003795782.1 | periplasmic mercury ion binding protein | BAC0674 | Protein | 2e-19 | 57 |
